element83 on Scratch

element83

Scratcher Joined 1 year ago Antarctica

About me

aa wagwag wgaa aaaa agw wag gwag
they/them
my genome is GCATGCGATGACTTAGCTGTCGTATATCGAGTCGATATATACGACGTCGACGTAGTCAGTATTCGAGTCAGTCTGACGGTCGTCGTACAATGATCGTAGCTGATCGATGCATGCTATCGATGCTAGTCAGTGCATCGATCGTAA

What I'm working on

emitting sodium chlorinated dihydrogen monoxide from my eyes

rest in peace astronomical
they knew how to count real good

Featured Project

How do electrons generate electricity?

What I've been doing

Shared Projects (18)

View all

am i online by element83
Sentence Destroyer by element83
How do electrons generate electricity? by element83
Saturday Evening Swingin' (very old) by element83
bismuthPC by element83
get your perscription refilled by element83
watch this block of francium-221 by element83
ruh roh raggy by element83
amayah's bad math day by element83
amayah goes to school by element83
multi-use astronomical calculator by element83
nah by element83
Solar System Loudness Visualizer by element83
RNG Solar System by element83
gnap gnap-9 system in motion by element83
gnarp gnap-9 by element83
stanley simulator by element83
stanley from tsp says letters and then moves by element83

Favorite Projects

View all

Studios I'm Following

View all

Studios I Curate

View all

Following

View all

Followers

View all

Comments

Comments loading...